As indicated on other pages on this site, I had my genome analyzed in May 2008 by deCODEme, a division of Decode Genetics in Reykjavik, Iceland. (Decode is no longer offering their direct-to-consumer DNA testing services.)
In November 2008, I had a further analysis done by 23andMe.
These companies did not decode the entire genome, but they decoded many of the points of human DNA that are the most common variations among different individuals.
My experiences as a genomic early adopter have been used in at least two medical journal articles:
McGowan, et al., Department of Bioethics, Case Western Reserve University. Personal genomics and individual identities: motivations and moral imperatives of early users. New Genetics and Society. September 1, 2010; 29(3): pp. 261-290. (I am quoted three times in this article, but only identified as User 17.)
Do, et al., Web-Based Genome-Wide Association Study Identifies Two Novel Loci and a Substantial Genetic Component for Parkinson's Disease. PLoS Genetics. June 23, 2011. 7(6): e1002141. doi:10.1371/journal.pgen.1002141 (My genome is not specifically mentioned in this article, but was used in the genomic data. My paternal grandmother had Parkinson's Disease in her 80s, and it was presumed to be the cause of her death.)
I became a genomic early adopter because my previous experiences indicated that these new innovations for advancing individual control over, and enhancement of, one's own health are often shut down early on by government agencies.
If you want to obtain your complete health risk information from your DNA file, you may have to either consult with a professional, or else analyze your raw 23andMe DNA file as I have done (as described in this article). This situation, however, is constantly changing. The prices of the 23andMe DNA scan, as well as the health risk information that the FDA will allow 23andMe to reveal, have both changed considerably in recent years. Consult the 23andMe web site for current information and updates.
What else you will find on this page:
For an excellent introduction to genomics and tutorials on the basics of how DNA works, see the outstanding Learn Genetics site at the University of Utah, which was named by Science magazine in January, 2010 as the best science education site of the year.
The summary of my genetic health risks at birth from my DNA scan from DeCODEme are shown at:
My Y haplogroup is I1d. The DNA results of my Y chromosome ancestry (male-line) are shown at:
My mitochondrial haplogroup is H4a. My DNA mitochondrial ancestry (female-line) are at:
The summary given by deCODEme.com for genetic health risks is actually only a very small part of the health risk information that is given in all one million plus SNPs. New reports about the effects of human DNA polymorphisms is coming in at the rate of hundreds per year, and that rate will probably be greatly increasing in the future.
I have put my complete deCODEme file of 1,013,349 SNPs online, but the entire file is about 31 megabytes with more than a million lines of raw data, and is only of interest to those seriously interested in learning about SNPs in human DNA. My complete 31 MB deCODEme data file is at:
My complete 23andMe raw data file is a large tab-delimited file that will not be of interest to most people, but it is online on this site at:
The above 23andMe file is a report on 579,751 SNPs.
These raw DNA files generally have to be loaded into Microsoft Excel 2007 in order to be viewable in any logical fashion. The files are too large for most other spreadsheets.
I have used the software called Promethease to compare my DNA scans with the information in the SNPedia. Promethease is easy to use and even the version with the enhanced output is very inexpensive.
There is a video tutorial on YouTube about how to download your raw DNA file from 23andMe and analyze it using Promethease. If you have no familiarity at all with genomic terminology, then some of the information can appear very strange and daunting at first. Once you are looking at your own information, though, things usually start becoming clear fairly rapidly.
It does take several minutes to complete the software analysis, even with the accelerated paid Promethease report, because you are processing an enormous amount of information. In the video, it says that it takes about 5 minutes to process the information, but if you have a slower internet connection it could easily take several minutes longer. (I would not recommend this process using a dial-up connection because certain steps would take hours.)
Very old versions of my Promethease reports are available online at:
Jerry's Promethease Report for pooled data for both scans. (About 17 megabytes.)
I probably won't be keeping my Promethease reports up-to-date on this futurescience.com web site as often as I have in the past since this is rapidly becoming impractical.
My relevant genetic family health history:
My Decodeme and 23andme scans showed four major health risk areas:
1. Age-related macular degeneration (ARMD).
2. Rheumatoid Arthritis
3. Cardiovascular disease
4. Osteoporosis
ARMD. I was aware of the genetic tendency toward ARMD. There were several cases of ARMD on my father's side of the family. My father was legally blind because of ARMD during the last several years of his life. He could not read or drive from about the age of 78 until his death at the age of 84. I have been taking the nutrients lutein and zeaxanthin, among others, to prevent ARMD since about 1995. I try to keep the exposure of my eyes to ultraviolet light to a minimum, and I get annual retinal scans, which have, so far, shown no sign of vision loss due to macular degeneration. I do have significant amounts of drusen (a waste product usually associated with macular degeneration) visible in my retina, but the levels do not seem to be increasing over the past few years.
Rheumatoid Arthritis. I don't have rheumatoid arthritis, although my sister has a very mild case of rheumatoid arthritis. I have a form of arthritis that is noticeable in one finger joint (the distal joint of my right index finger). I also have a very small, but detectable, amount of this same form of arthritis in one other distal finger joint. (The distal joint is the joint nearest the fingernail.) This distal joint arthritis is sometimes psoriatic arthritis (which is related to rheumatoid arthritis), but it also may be the much more common osteoarthritis. (It is such a minor problem for me that I've never had it tested.)
My mother had the same form of arthritis which caused some of her finger joints to become enlarged, but did not cause any discomfort. During the last year of her life, she exhibited some autoimmune disorders (that may have been related to these rheumatoid arthritis SNPs), and one of those late-developing autoimmune disorders (in her lungs) was a primary cause of her death at age 83. This condition was never precisely identified, but her medical symptoms in the last few years of her life, and the cause of her death, seemed to be a textbook case of a very rare autoimmune disease called Goodpasture's Syndrome.
I will need to be on the lookout for autoimmune diseases and inflammation. My first choice of treatment, if I do get a significant autoimmune disease, would be either anatabine or low-dose naltrexone.
Cardiovascular Disease. My cardiovascular disease risks as shown on my SNP scan illustrates that these scans show the risks that you were born with, and not the risk that you necessarily have today.
My SNP scan shows that I was born with a 30 to 40 percent above average risk for cardiovascular disease; however I have been very diligent, especially during the past 30 years, to do everything possible to eliminate my risk for cardiovascular disease. Because of this, comprehensive blood tests now show that my cardiovascular disease risk is less that half of that of the average person.
Cardiovascular disease is the most common cause of death among my relatives, although most were in their eighties at the time. (One uncle did die of a heart attack at age 77, but he lived alone on a wheat farm and had a very unhealthy diet that consisted largely of rancid fats, and it always amazed me that he lived as long as he did. My father had a minor heart attack at age 71, but he had the good sense to have his heart attack in a doctor's office.)
Osteoporosis. This is the really interesting one. My father died as a direct result of spinal osteoporosis. He was under full-time hospital or nursing care during the last 14 months of his life because of that condition. This care cost him more than $60,000 of his own money in addition to depriving him of his health and freedom (in addition to the fact that having your spine slowly crumble away is not a pleasant way to die.) His osteoporosis was also very likely a major contributor to my mother's death a few months later because of the psychological stress.
My father's three brothers also had severe osteoporosis in their later years. After my father died, I had a DEXA scan that revealed a greatly decreased bone mineral density, especially in my lumbar spine. I began using the prescription medicine Boniva, and started being even more diligent in making sure that I had adequate levels of vitamin D3, vitamin K2 and calcium. I also added strontium citrate to my nutrient regimen in 2007. I discontinued my use of Boniva in April 2009 since hormonal control seemed to be dramatically reversing the osteoporosis.
The genetic osteoporosis problem was a major reason why I decided to get a DNA SNP scan. My SNP analysis, along with other medical testing, indicates that part of the problem is with polymorphisms in the IGF-1 gene on chromosome 12. How well I had maintained my bone density in the measured period up through May, 2008 had been directly proportional to my IGF-1 levels.
The SNP that appears to have the greatest responsibility for my genetic osteoporosis, though, is rs17703883, located at position 49,317,389 on chromosome 15. This is on the CYP19A1 gene that produces the enzyme aromatase. Aromatase is the enzyme responsible for converting androstenedione to estrone and testosterone to estradiol. Estrone and estradiol are the two most active estrogens in the human body. Estrogens are critically necessary for health in both the male and female bodies. In younger adults, including males, estrogens are necessary for the closing of the epiphyses (growth plates) at the ends of the long bones when an individual reaches one's adult height. In all humans, whether male or female, estrogens are necessary to maintain bone mineral density. Estrogens also have other important functions in both males and females.
Most older males have a problem with increasing aromatase activity with age, which causes most men past middle age to have too much estrogen. A small percentage of males, however, have inadequate aromatase activity, usually of a type that only appears with increasing age, resulting in an estrogen deficiency that can be lethal. Even though the percentage is small, the number of males with estrogen deficiency is very large.
My rs17703883 SNP is C (cytosine instead of thymine) on both copies of chromosome 15. This apparently causes me to have an altered form of aromatase and decreased aromatase activity with increasing age. So unlike most males of my age, my testosterone to estrogen ratio is much too high. When I was younger, my aromatase activity was normal. In spite of using supplemental testosterone and DHEA for about the last 13 years to normalize my blood levels of these hormones, my natural aromatase enzyme cannot convert enough of my testosterone and androstenedione to estrogens to maintain adequate bone density. According to one study of U.S. residents of European descent, 3.3 percent had this same rs17703883(C,C) polymorphism in their DNA. In some other genetic groups, this polymorphism is present in more than 9 percent of the population. This polymorphism is not the only cause of estrogen deficiency in males.
Assuming that the nearby base pairs on this gene match the human reference sequence, the result of my defective rs17703883 SNP is a DNA sequence around the SNP that looks like this:
TTTCAGGAGTTGACAAGTAGCAGTTTCTCTAAATCTTTCTCCTTTAATTCCA
when it should look like this:
TTTCAGGAGTTGACAAGTAGCAGTTTTTCTAAATCTTTCTCCTTTAATTCCA
Keep in mind that, in the full DNA sequence, there are more about 2.4 billion letters on the left side of the above sequence and about a half billion letters on the right side. So you can see that a tiny, single change in the three billion base pairs in human DNA can cause enormous human suffering. Most of these variations, though, actually occur along with other variations that may still be undiscovered. In my case, for example, the above DNA polymorphism may only be a marker for this aromatase problem. The true problem area may be at another location that just travels along on the genome with this particular variation.
With the amount of data available so far, it is impossible to say, with any very high degree of probability, whether the SNP above was the cause of my former osteoporosis. It may have been the entire cause, a part of the cause, or it may have been unrelated. What is known is that finding the rs17703883(C,C) SNP is what led me directly to checking my estradiol level, and subsequently to reversing my spinal osteoporosis.
My father never did have any hormone testing during his life, and he was never prescribed any kind of hormone supplementation, so it is easy to see how his bones would have deteriorated rapidly due to lack of estrogen (in addition to an IGF-1 problem that it is likely that he also had).
In July, 2008, I started on a low dose of transdermal estradiol replacement. This brought my estradiol level up from 18 pg/ml to 32 pg/ml, which is right where I wanted it to be. (A subsequent test in May, 2009 put my estradiol level at 29 pg/ml.) According to me, the standard optimal range for estradiol in adult males is 30 to 35 pg/ml. Results of a DEXA bone density scan on May 6, 2009 indicated an increase in spinal bone density of 20.1 percent during the previous year. This is a very large and beneficial increase in spinal bone density in a single year. By comparison, composite results of the density of my L1-L3 vertebrae decreased by 3 percent from April, 2006 to May, 2007; and decreased by an additional 13.6 percent from May, 2007 to May, 2008.
A DEXA scan in June, 2012 indicated that my spinal bone density was 19.3 percent higher now than it was at my first DEXA scan in April, 2006. My spinal bone density is now 42.5 percent higher than it was at the lowest point in May, 2008. I am no longer in the osteoporosis range.
My last three DEXA scans may overstate my bone mineral density somewhat because of my use of supplemental strontium (which has a greater X-ray cross-section than calcium), however medical journal reports in recent years have shown that strontium-containing bones are significantly more fracture-resistant than bones of the same density where calcium is the only mineral component. Also, I was using strontium citrate during the 2007 to 2008 period when my lumbar spinal density decreased by more than 13 percent, so the strontium supplements cannot account for any significant part the large increase in bone density in the first year (2008 to 2009) of using both supplemental estradiol and supplemental growth hormone.
There is no practical way to estimate how much strontium my bones actually contain since this would require a bone biopsy followed by an expensive chemical analysis. (The Discovery units used for my DEXA scan do tend to overestimate the density of strontium-containing bone more than the machines made by other manufacturers.)
My DEXA scan summaries for both spine and hip are online as a PDF file at:
I haven't been able to afford growth hormone since 2010, so my IGF-1 levels have dropped considerably. I've been able to sustain a continued increase in spinal bone density (although the rate of increase is lower) by using topical estradiol plus strontium citrate and an increased dose of vitamin D3. (I get between 5,000 and 10,000 units of vitamin D3 per day.)
My four latest annual blood chemistry tests are online, with my comments. My blood chemistry page shows the link to the results of my 2010 blood tests and a link to another page showing my blood tests for the earlier three years. I will have more blood chemistry data online soon.
I have several medical journal article references below about the recently-discovered problem of low estrogen levels in some men. It now appears that for adult males, optimal estradiol levels are in a fairly narrow range of 30 to 35 pg/ml. Some physicians recommend temporarily higher estradiol levels for males with severely low bone mineral density. In males, sustained estradiol levels much higher than this range can cause prostate problems and other health problems.
Anyone whose personal physician is reluctant to order an estradiol test can order their own
Estradiol Blood Test through the Life Extension Foundation.
Bilezikian J P. What’s Good for the Goose’s Skeleton is Good for the Gander’s Skeleton. 2006: The Journal of Clinical Endocrinology and Metabolism. Vol. 91, No. 4 1223-1225.
Gennari L, Nuti R and Bilezikian J P. Aromatase Activity and Bone Homeostasis in Men. 2004: The Journal of Clinical Endocrinology and Metabolism. Vol. 89, No. 12 5898-5907.
Khosla S, Melton III LJ, Riggs BL. Estrogen and the male skeleton. 2002: Journal of Clinical Endocrinology and Metabolism. Vol. 87, No. 4, 1443-1450.
Ohlsson, C. and Vandeput, L. The Role of Estrogens for Male Bone Health. 2009: European Journal of Endocrinology, Vol. 160, Issue 6, 883-889.
de Ronde W, Pols HAP, van Leeuwen JPTM, de Long FH. The importance of estrogen in males. 2003: (May) Clinical Endocrinology Vol. 58, No. 5, 529-542.
Khosla, S., Amin, S and Orwoll, E. Osteoporosis in Men. 2008: Endocrine Reviews, Vol. 29, Issue 4, 441-464.
Slemenda C, Longcope C, Zhou L, Hui SL, Peacock M, Johnston CC. Sex steroids and bone mass in older men: positive associations with serum estrogens and negative associations with androgens. 1997: Journal of Clinical Investigation. Vol. 100, 1755-1759.
Khosla S, Melton III LJ, Atkinson EJ, O’Fallon WM. Relationship of Serum Sex Steroid Levels to Longitudinal Changes in Bone Density in Young Versus Elderly Men. 2001: The Journal of Clinical Endocrinology and Metabolism. Vol. 86, No. 8, 3555-3561
Van Pottelbergh I, Goemaere S, Kaufman JM. Bioavailable estradiol and aromatase gene polymorphism are determinants of bone mineral density changes in men over 70 years of age. 2003: Journal of Clinical Endocrinology and Metabolism. Vol. 88, No. 7, 3075-3081
Bilezikian JP, Khosla S, Riggs BL. "Estrogen effects on bone in the male skeleton". In: Bilezikian JP, Raisz LG, Rodan GA, eds. Principles of bone biology. 2002: San Diego: Academic Press; 1467-1476.
Rochira V, Faustini-Fustini M, Balestrieri A, Carani C. Estrogen replacement therapy in a man with congenital aromatase deficiency effects of different doses of transdermal estradiol on bone mineral density and hormonal parameters. 2000: The Journal of Clinical Endocrinology and Metabolism. Vol. 85, No. 5, 1841-1845.