Comments by Jerry Emanuelson on my DNA SNP scans
(with medical journal references).

Note:    Before clicking the two links immediately below, please be warned that this takes you to very large DNA data files in csv or tab-delimited formats.   The raw data will not be of any interest to most people; but if you are interested, it can be loaded into a word processor for searching by rs number for particular polymorphisms.   It can be viewed in a more organized fashion using Excel 2007.    Most other spreadsheet software will truncate the files.  The first DNA file is 1,013,349 lines long.   The second file is 579,751 lines long.

The entire raw data file of my DeCODEme DNA scan is available on this site as a 32MB csv file at:

http://www.futurescience.com/DNA/jerry-deCODEme-scan.csv

The entire raw data file of my 23andMe DNA scan are available on this site as a 15 MB tab-delimited file at:

http://www.futurescience.com/DNA/jerry-23andme-scan.txt

I have posted the above raw data file mostly so others can see an example of the raw data file that they will get if they decide to get a DNA SNP scan.  (The new 23andMe files are larger than mine since they are now scanning more DNA variants.)  DeCodeMe has discontinued its direct-to-consumer DNA testing services.

The Promethease analysis, comparing my DNA scan to information in the SNPedia was last run on my computer for my deCODEme file only on August 16, 2009 (updating the analyses that appeared previously on this web site).  A separate Promethease analysis for my 23andMe file only was run on August 21, 2009. 

(SNPedia is a Wikipedia-like encyclopedia of DNA variants.  Promethease is computer software that compares an individual's DNA variants to all of the variants listed in the SNPedia.  Promethease is very valuable to people like me who have had DNA scans through companies like 23andMe.com and DecodeMe.)

A Promethease analysis of the pooled information in both files was run on July 11, 2010.  That 17 megabyte file (shown as a long web page) is at:

http://www.futurescience.com/DNA/jerry-pooled-snpedia.html

The amount of information in the Promethease analysis is getting to be so massive that the results are just too large of a file to run and update very frequently.  There are more than 14,000 SNPs in SNPedia; and it is compared against my personal SNP files of well over one million SNPs, so you can understand that the total amount of information from a Promethease scan can be quite immense.

For information about how to read the Promethease report, you can watch this video on interpreting Promethease results, which is now available on Youtube.  For links to other aspects of my DNA analysis and medical history, see Jerry's DNA links page.

I'll re-run these analyses periodically to keep things up-to-date.   I'll also be scanning medical journal articles frequently for new disease-risk-related SNP discoveries, which are now coming in a such a rapid rate that even SNPedia can't possibly keep up.   I am very grateful, though, to Mike Cariaso and the other people who keep the SNPedia going.   The SNPedia and the Promethease software are very valuable resources.

Nearly everyone has gene variants that double the risk of certain things and other variants that cut the risk of the same condition in half.   Even with a Promethease analysis, you have to look at the big picture, and try to correlate the DNA analysis with actual family history and medical testing.   This type of analysis, though, is becoming an increasingly important part of the overall personal knowledge base for really effective preventive medicine.

The Promethease software is available free at the SNPedia web site.   There was an interesting news article on SNPedia and Promethease in the November 6, 2008 issue of Nature.

The SNPedia will have a more recent version of my Promethease Report since they upgrade the software and gather more SNPs quite frequently.

My SNP (DNA single nucleotide polymorphism) scan was made by Decodeme.com of Reykjavik, Iceland in May, 2008 (at age 60).   An additional scan by 23andme.com was completed on November 25, 2008.   My Decodeme and 23andme scans showed four major health risk areas:

      1. Age-related macular degeneration (ARMD).

      2. Rheumatoid Arthritis

      3. Cardiovascular disease

      4. Osteoporosis

ARMD.   I was aware of the genetic tendency toward ARMD.    There were several cases of ARMD on my father's side of the family.    My father was legally blind because of ARMD during the last several years of his life.   He could not read or drive from about the age of 78 until his death at the age of 84.   I have been taking the nutrients lutein and zeaxanthin, among others, to prevent ARMD since about 1995.   I try to keep the exposure of my eyes to ultraviolet light to a minimum, and I get annual retinal scans, which have, so far, shown no sign of macular degeneration.

Rheumatoid Arthritis.   I don't have rheumatoid arthritis, although my sister has a mild case of rheumatoid arthritis.      I have a form of arthritis that is noticeable in one finger joint (the distal joint of my right index finger).   I also have a very small, but detectable, amount of this same form of arthritis in one other distal finger joint.   (The distal joint is the joint nearest the fingernail.)   This distal joint arthritis is often psoriatic arthritis (which is related to rheumatoid arthritis), but it also may be osteoarthritis.  (It is such a minor problem for me that I've never had it tested.)

My mother had the same form of arthritis which caused some of her finger joints to become enlarged, but did not cause any discomfort.   During the last year of her life, she exhibited some autoimmune disorders (that may have been related to these rheumatoid arthritis SNPs), and one of those late-developing autoimmune disorders (in her lungs) was a primary cause of her death at age 83.   This condition was never precisely identified, but her medical symptoms in the last few years of her life, and the cause of her death, seemed to be identical to a very rare autoimmune disease called Goodpasture's Syndrome.

I will need to be on the lookout for autoimmune diseases and inflammation.  My first choice of treatment, if I do get a significant autoimmune disease, would be either anatabine or low-dose naltrexone.

Cardiovascular Disease.   My cardiovascular disease risks as shown on my SNP scan illustrates that these scans show the risks that you were born with, and not the risk that you necessarily have today.

My SNP scan shows that I was born with a 30 to 40 percent above average risk for cardiovascular disease; however I have been very diligent, especially during the past 30 years, to do everything possible to eliminate my risk for cardiovascular disease.   Because of this, comprehensive blood tests now show that my cardiovascular disease risk is less that half of that of the average person.   (Labcorp rates my cardiovascular risk from my lipid profile alone at less than 50 percent of average, and other factors measured by my recent medical tests appear to drop the risk even further.)  

Cardiovascular disease is the most common cause of death among my relatives, although most were in their eighties at the time.   (One uncle did die of a heart attack at age 77, but he lived alone on a wheat farm and had a very unhealthy diet that consisted largely of rancid fats, and it always amazed me that he lived as long as he did.   My father had a minor heart attack at age 71, but he had the good sense to have his heart attack in a doctor's office.)

Osteoporosis.   This is the really interesting one.  My father died as a direct result of spinal osteoporosis.  He was under full-time hospital or nursing care during the last 14 months of his life because of that condition.  This care cost him more than $60,000 of his own money in addition to depriving him of his health and freedom (in addition to the fact that having your spine slowly crumble away is not a pleasant way to die.)   His osteoporosis was also very likely a major contributor to my mother's death a few months later because of the psychological stress.

My father's three brothers also had severe osteoporosis in their later years.  After my father died, I had a DEXA scan that revealed a greatly decreased bone mineral density, especially in my lumbar spine.   I began using the prescription medicine Boniva, and started being even more diligent in making sure that I had adequate levels of vitamin D3, vitamin K2 and calcium.   I also added strontium citrate to my nutrient regimen in 2007.  I discontinued my use of Boniva in April 2009 since hormonal control seemed to be dramatically reversing the osteoporosis.

The genetic osteoporosis problem was a major reason why I decided to get a DNA SNP scan.   My SNP analysis, along with other medical testing, indicates that part of the problem is with polymorphisms in the IGF-1 gene on chromosome 12.  How well I had maintained my bone density in the measured period up through May, 2008 had been directly proportional to my IGF-1 levels.

The SNP that appears to have the greatest responsibility for my genetic osteoporosis, though, is rs17703883, located at position 49,317,389 on chromosome 15.   This is on the CYP19A1 gene that produces the enzyme aromatase.   Aromatase is the enzyme responsible for converting androstenedione to estrone and testosterone to estradiol.   Estrone and estradiol are the two most active estrogens in the human body.    Estrogens are critically necessary for health in both the male and female bodies.   In younger adults, including males, estrogens are necessary for the closing of the epiphyses (growth plates) at the ends of the long bones when an individual reaches one's adult height.   In all humans, whether male or female, estrogens are necessary to maintain bone mineral density.  Estrogens also have other important functions in both males and females.

Most older males have a problem with increasing aromatase activity with age, which causes most men past middle age to have too much estrogen.   A small percentage of males, however, have inadequate aromatase activity, usually of a type that only appears with increasing age, resulting in an estrogen deficiency that can be lethal.  Even though the percentage is small, the number of males with estrogen deficiency is very large.

My rs17703883 SNP is C (cytosine instead of thymine) on both copies of chromosome 15.  This apparently causes me to have an altered form of aromatase and decreased aromatase activity with increasing age.   So unlike most males of my age, my testosterone to estrogen ratio is much too high.   When I was younger, my aromatase activity was normal.  In spite of using supplemental testosterone and DHEA for about the last 13 years to normalize my blood levels of these hormones, my natural aromatase enzyme cannot convert enough of my testosterone and androstenedione to estrogens to maintain adequate bone density.   According to one study of U.S. residents of European descent, 3.3 percent had this same rs17703883(C,C) polymorphism in their DNA.  In some other genetic groups, this polymorphism is present in more than 9 percent of the population.  This polymorphism is not the only cause of estrogen deficiency in males.

Assuming that the nearby base pairs on this gene match the human reference sequence, the result of my defective rs17703883 SNP is a DNA sequence around the SNP that looks like this:

      TTTCAGGAGTTGACAAGTAGCAGTTTCTCTAAATCTTTCTCCTTTAATTCCA

when it should look like this:

      TTTCAGGAGTTGACAAGTAGCAGTTTTTCTAAATCTTTCTCCTTTAATTCCA

Keep in mind that, in the full DNA sequence, there are more about 2.4 billion letters on the left side of the above sequence and about a half billion letters on the right side.   So you can see that a tiny, single change in the three billion base pairs in human DNA can cause enormous human suffering.  (Most of these variations, though, actually occur along with other variations that may still be undiscovered.)

With the amount of data available, it is impossible to say, with any very high degree of probability, whether the SNP above was the cause of my former osteoporosis.  It may have been the entire cause, a part of the cause, or it may have been unrelated.  What is known is that finding the rs17703883(C,C) SNP is what led me directly to checking my estradiol level, and subsequently to reversing my spinal osteoporosis.

My father never did have any hormone testing during his life, and he was never prescribed any kind of hormone supplementation, so it is easy to see how his bones would have deteriorated rapidly due to lack of estrogen (in addition to an IGF-1 problem that it is likely that he also had).

In July, 2008, I started on a low dose of transdermal estradiol replacement.   This brought my estradiol level up from 18 pg/ml to 32 pg/ml, which is right where I wanted it to be.  (A subsequent test in May, 2009 put my estradiol level at 29 pg/ml.)  According to me, the standard optimal range for estradiol in adult males is 30 to 35 pg/ml.  Results of a DEXA bone density scan on May 6, 2009 indicated an increase in spinal bone density of 20.1 percent during the previous year.  This is a very large and beneficial increase in spinal bone density in a single year.  By comparison, composite results of the density of my L1-L3 vertebrae decreased by 3 percent from April, 2006 to May, 2007; and decreased by an additional 13.6 percent from May, 2007 to May, 2008.

A DEXA scan in June, 2012 indicated that my spinal bone density was 19.3 percent higher now than it was at my first DEXA scan in April, 2006.  My spinal bone density is now 42.5 percent higher than it was at the lowest point in May, 2008.  I am no longer in the osteoporosis range.

My last three DEXA scans may overstate my bone mineral density somewhat because of my use of supplemental strontium, however medical journal reports in recent years have shown that strontium-containing bones are significantly more fracture-resistant than bones of the same density where calcium is the only mineral component.  Also, I was using strontium citrate during the 2007 to 2008 period when my lumbar spinal density decreased by more than 13 percent, so the strontium supplements cannot account for any significant part the large increase in bone density in the first year (2008 to 2009) of using both supplemental estradiol and supplemental growth hormone.

There is no practical way to estimate how much strontium my bones actually contain since this would require a bone biopsy followed by an expensive chemical analysis.   (The Discovery units used for my DEXA scan do tend to overestimate the density of strontium-containing bone more than the machines made by other manufacturers.)

My DEXA scan summaries for both spine and hip are online as a PDF file at:

http://www.futurescience.com/dna/Jerry-DEXA-2012.pdf

I haven't been able to afford growth hormone for the past two years, so my IGF-1 levels have dropped considerably.  I've been able to sustain a continued increase in spinal bone density (although the rate of increase is lower) by using topical estradiol plus strontium citrate and an increased dose of vitamin D3.  (I get between 5,000 and 10,000 units of vitamin D3 per day.)

My four latest annual blood chemistry tests are online, with my comments.   My blood chemistry page shows the link to the results of my 2010 blood tests and a link to another page showing my blood tests for the earlier three years.  I will put the results of more recent blood test online later.

I have several medical journal article references below about the recently-discovered problem of low estrogen levels in some men.   It now appears that for adult males, optimal estradiol levels are in a fairly narrow range of 30 to 35 pg/ml.   Some physicians recommend temporarily higher estradiol levels for males with severely low bone mineral density.  In males, sustained estradiol levels much higher than this range can cause prostate problems and other health problems.

Anyone whose personal physician is reluctant to order an estradiol test can order their own Estradiol Blood Test through the Life Extension Foundation.

Jerry Emanuelson

email:   lifex@futurescience.com

The Preface to the Life Extension Manual has links to other information from my DNA SNP scans, and even more concise links are on my personal DNA links page.

The comments on this page are in reference to my Promethease scan (a 17 megabyte file) as shown on this web site at:

http://www.futurescience.com/DNA/jerry-pooled-snpedia.html

References:

Bilezikian J P.  What’s Good for the Goose’s Skeleton is Good for the Gander’s Skeleton.  2006:  The Journal of Clinical Endocrinology and Metabolism. Vol. 91, No. 4 1223-1225.

Gennari L, Nuti R and Bilezikian J P.  Aromatase Activity and Bone Homeostasis in Men.  2004:  The Journal of Clinical Endocrinology and Metabolism. Vol. 89, No. 12 5898-5907.

Khosla S, Melton III LJ, Riggs BL.  Estrogen and the male skeleton.  2002:  Journal of Clinical Endocrinology and Metabolism. Vol. 87, No. 4, 1443-1450.

Ohlsson, C. and Vandeput, L.  The Role of Estrogens for Male Bone Health.  2009:  European Journal of Endocrinology, Vol. 160, Issue 6, 883-889.

de Ronde W, Pols HAP, van Leeuwen JPTM, de Long FH.  The importance of estrogen in males.  2003:  (May) Clinical Endocrinology Vol. 58, No. 5, 529-542.

Khosla, S., Amin, S and Orwoll, E.  Osteoporosis in Men.  2008:  Endocrine Reviews, Vol. 29, Issue 4, 441-464.

Slemenda C, Longcope C, Zhou L, Hui SL, Peacock M, Johnston CC.  Sex steroids and bone mass in older men: positive associations with serum estrogens and negative associations with androgens.  1997:  Journal of Clinical Investigation. Vol. 100, 1755-1759.

Khosla S, Melton III LJ, Atkinson EJ, O’Fallon WM.  Relationship of Serum Sex Steroid Levels to Longitudinal Changes in Bone Density in Young Versus Elderly Men.  2001:  The Journal of Clinical Endocrinology and Metabolism. Vol. 86, No. 8, 3555-3561

Van Pottelbergh I, Goemaere S, Kaufman JM.  Bioavailable estradiol and aromatase gene polymorphism are determinants of bone mineral density changes in men over 70 years of age.  2003:  Journal of Clinical Endocrinology and Metabolism. Vol. 88, No. 7, 3075-3081

Bilezikian JP, Khosla S, Riggs BL.  "Estrogen effects on bone in the male skeleton". In: Bilezikian JP, Raisz LG, Rodan GA, eds. Principles of bone biology.  2002:  San Diego: Academic Press; 1467-1476.

Rochira V, Faustini-Fustini M, Balestrieri A, Carani C.  Estrogen replacement therapy in a man with congenital aromatase deficiency effects of different doses of transdermal estradiol on bone mineral density and hormonal parameters.  2000:  The Journal of Clinical Endocrinology and Metabolism. Vol. 85, No. 5, 1841-1845.

 



Life Extension Membership


The Life Extension Foundation has very good prices on a wide variety of blood testing by one of the largest testing laboratories in the United States.  The samples are taken at any one of the more than 1600 Labcorp sites across the United States.

Life Extension Blood Testing

Bone Restore - Life Extension